742043, 742043 (genetic_marker) Cicer arietinum

Name	742043
dbSNP ID	N/A
Type	SNP
SNP Alleles	G/A
Species	Cicer arietinum
Primer 1	742043.Forward primer: TCAATCAAAGAAACCCAACC
Primer 2	742043.Reverse primer: TACAGAACAATCGCAGCTCT
Publication	[view all]
Contact	Stefano Pavan

Name	Details
Stefano Pavan	First name: Stefan Last name: Pavan Title: Researcher Institution: University of Bari Aldo Moro Address: Dep. of Soil, Plant and Food Science, Univ. of Bari Aldo Moro, Via Amendola 165/A, 70126 Bari, Italy Country: Italy Email: stefano.pavan@uniba.it

Database	Accession
DB:genbank	reverse primer

Year	Publication
2017	Pavan S, Lotti C, Marcotrigiano AR, Mazzeo R, Bardaro N, Bracuto V, Ricciardi F, Taranto F, D'Agostino N, Schiavulli A, De Giovanni C, Montemurro C, Sonnante G, Ricciardi L. A Distinct Genetic Cluster in Cultivated Chickpea as Revealed by Genome-wide Marker Discovery and Genotyping. The Plant Genome. 2017; 10.