PLC83, PLC83 (genetic_marker) Lens culinaris

Marker Overview
NamePLC83
Genbank IDN/A
TypeSSR
SpeciesLens culinaris
Repeat Motif(GTG)8
Primer 1PLC83.Forward Primer: GTTCGGTTTTGTTGGAAGTGAG
Primer 2PLC83.Reverse Primer: TCCTTCTTTCAGCCATGAGATT
Publication[view all]
ContactHarsh Dikshit
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerPLC83.Forward PrimerLens culinarisprimer
Reverse PrimerPLC83.Reverse PrimerLens culinarisprimer


Contact
NameDetails
Harsh Dikshit
First name:Harsh
Last name:Dikshit
Title:Researcher
Institution:Indian Agricultural Research Institute
Address:Division of Genetics, Indian Agricultural Research Institute, New Delhi 110012, India
Country:India
Email:harshgeneticsiari@gmail.com