|
|
Marker Overview
| Name | PLC100 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Lens culinaris |
|---|
| Repeat Motif | (TTG)9 |
|---|
| Primer 1 | PLC100.Forward Primer: TGCTTTACTTCCTTCTCTCTTTGC |
|---|
| Primer 2 | PLC100.Reverse Primer: TAAGCCATCCACTTGCATCC |
|---|
| Publication | [view all] |
|---|
| Contact | Harsh Dikshit
|
|---|
Relationships
This genetic_marker is adjacent to the following primer feature(s):
| Feature Name | Unique Name | Species | Type |
|---|
| Forward Primer | PLC100.Forward Primer | Lens culinaris | primer |
| Reverse Primer | PLC100.Reverse Primer | Lens culinaris | primer |
The following marker_locus feature(s) are an instance of this genetic_marker:
| Feature Name | Unique Name | Species | Type |
|---|
| PLC100 | PLC100 | Lens culinaris | marker_locus |
Publications
| Year | Publication |
|---|
| 2016 | Singh A, Dikshit HK, Singh D, Jain N, Aski M, Sarker A, Sharma TR. Use of expressed sequence tag microsatellite markers for exploring genetic diversity in lentil and related wild species. 2016; 1-16. |
| 2017 | Singh A, Sharma V, Dikshit HK, Aski M, Kumar H, Thirunavukkarasu N, Patil BS, Kumar S, Sarker A. Association mapping unveils favorable alleles for grain iron and zinc concentrations in lentil (Lens culinaris subsp. culinaris). PloS one. 2017; 12(11):e0188296. |
|
