PLC100, PLC100 (genetic_marker) Lens culinaris

Name	PLC100
Genbank ID	N/A
Type	SSR
Species	Lens culinaris
Repeat Motif	(TTG)9
Primer 1	PLC100.Forward Primer: TGCTTTACTTCCTTCTCTCTTTGC
Primer 2	PLC100.Reverse Primer: TAAGCCATCCACTTGCATCC
Publication	[view all]
Contact	Harsh Dikshit

Name	Details
Harsh Dikshit	First name: Harsh Last name: Dikshit Title: Researcher Institution: Indian Agricultural Research Institute Address: Division of Genetics, Indian Agricultural Research Institute, New Delhi 110012, India Country: India Email: harshgeneticsiari@gmail.com

Year	Publication
2016	Singh A, Dikshit HK, Singh D, Jain N, Aski M, Sarker A, Sharma TR. Use of expressed sequence tag microsatellite markers for exploring genetic diversity in lentil and related wild species. 2016; 1-16.
2017	Singh A, Sharma V, Dikshit HK, Aski M, Kumar H, Thirunavukkarasu N, Patil BS, Kumar S, Sarker A. Association mapping unveils favorable alleles for grain iron and zinc concentrations in lentil (Lens culinaris subsp. culinaris). PloS one. 2017; 12(11):e0188296.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Lentil-BM4/L4602-F2	LG01	N/A	229.9	PLC100	View
2	Lentil-BM4/L4602-F3	LG01	N/A	287.9	PLC100	View
3	Lentil-BM4/L7903-F3	LG01	N/A	196.3	PLC100	View
4	Lentil-BM4/L7903-F6	LG01	N/A	119.9	PLC100	View