PLC100, PLC100 (genetic_marker) Lens culinaris

Marker Overview
NamePLC100
Genbank IDN/A
TypeSSR
SpeciesLens culinaris
Repeat Motif(TTG)9
Primer 1PLC100.Forward Primer: TGCTTTACTTCCTTCTCTCTTTGC
Primer 2PLC100.Reverse Primer: TAAGCCATCCACTTGCATCC
Publication[view all]
ContactHarsh Dikshit
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerPLC100.Forward PrimerLens culinarisprimer
Reverse PrimerPLC100.Reverse PrimerLens culinarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PLC100PLC100Lens culinarismarker_locus


Contact
NameDetails
Harsh Dikshit
First name:Harsh
Last name:Dikshit
Title:Researcher
Institution:Indian Agricultural Research Institute
Address:Division of Genetics, Indian Agricultural Research Institute, New Delhi 110012, India
Country:India
Email:harshgeneticsiari@gmail.com
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lentil-BM4/L4602-F2LG01N/A229.9PLC100View
2Lentil-BM4/L4602-F3LG01N/A287.9PLC100View
3Lentil-BM4/L7903-F3LG01N/A196.3PLC100View
4Lentil-BM4/L7903-F6LG01N/A119.9PLC100View