LC_03, LC_03 (genetic_marker) Lens culinaris

Marker Overview
NameLC_03
Genbank IDN/A
TypeSSR
SpeciesLens culinaris
Repeat Motif(CA)21(GA)25
Primer 1LC_03.Forward: GACTCATACTTTGTTCTTAGCAG
Primer 2LC_03.Reverse: GAACGGAGCGGTCACATTAG
Product Length289
Publication[view all]
ContactDharmendra Singh
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardLC_03.ForwardLens culinarisprimer
ReverseLC_03.ReverseLens culinarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
LC_03LC_03Lens culinarismarker_locus


Contact
NameDetails
Dharmendra Singh
First name:Dharmendra
Last name:Singh
Title:Researcher
Institution:Indian Agricultural Research Institute
Address:Division of Genetics, Indian Agricultural Research Institute, New Delhi-12, India
Country:India
Email:dsingh_gen@iari.res.in
Last update:Aug 2019
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lentil-JL-3/PDL-1-F2LG00N/A68.7LC_03View