PLC_105, PLC_105 (genetic_marker) Lens culinaris

Name	PLC_105
Genbank ID	N/A
Type	SSR
Species	Lens culinaris
Repeat Motif	(AT)4
Primer 1	PLC_105.Forward: CTCCCTCAAAATGCGTTGAT
Primer 2	PLC_105.Reverse: TCCATTACAAGATACTCTCCATGC
Product Length	200
Publication	[view all]
Contact	Dharmendra Singh

This genetic_marker is adjacent to the following primer feature(s):

Feature Name	Unique Name	Species	Type
Forward	PLC_105.Forward	Lens culinaris	primer
Reverse	PLC_105.Reverse	Lens culinaris	primer

This genetic_marker is adjacent to the following QTL feature(s):

Feature Name	Unique Name	Species	Type
Drought tolerance	qDRTL.JL-3/PDL-1.LG00	Lens culinaris	QTL

This genetic_marker is located in the following QTL feature(s):

Feature Name	Unique Name	Species	Type
Drought tolerance	qDRTL.JL-3/PDL-1.LG00	Lens culinaris	QTL

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature Name	Unique Name	Species	Type
PLC_105	PLC_105	Lens culinaris	marker_locus

Year	Publication
2016	SINGH D, SINGH CK, TOMAR RS, CHATURVEDI AK, SHAH D, KUMAR A, PAL M. Exploring genetic diversity for heat tolerance among lentil (Lens culinaris Medik.) genotypes of variant habitats by simple sequence repeat markers. Plant Breeding. 2016; (135)215-233.

Name	Details
Dharmendra Singh	First name: Dharmendra Last name: Singh Title: Researcher Institution: Indian Agricultural Research Institute Address: Division of Genetics, Indian Agricultural Research Institute, New Delhi-12, India Country: India Email: dsingh_gen@iari.res.in Last update: Aug 2019

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Lentil-JL-3/PDL-1-F2	LG00	N/A	92.2	PLC_105	View