PLC_105, PLC_105 (genetic_marker) Lens culinaris

Marker Overview
NamePLC_105
Genbank IDN/A
TypeSSR
SpeciesLens culinaris
Repeat Motif(AT)4
Primer 1PLC_105.Forward: CTCCCTCAAAATGCGTTGAT
Primer 2PLC_105.Reverse: TCCATTACAAGATACTCTCCATGC
Product Length200
Publication[view all]
ContactDharmendra Singh
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardPLC_105.ForwardLens culinarisprimer
ReversePLC_105.ReverseLens culinarisprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Drought toleranceqDRTL.JL-3/PDL-1.LG00Lens culinarisQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Drought toleranceqDRTL.JL-3/PDL-1.LG00Lens culinarisQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PLC_105PLC_105Lens culinarismarker_locus


Contact
NameDetails
Dharmendra Singh
First name:Dharmendra
Last name:Singh
Title:Researcher
Institution:Indian Agricultural Research Institute
Address:Division of Genetics, Indian Agricultural Research Institute, New Delhi-12, India
Country:India
Email:dsingh_gen@iari.res.in
Last update:Aug 2019
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lentil-JL-3/PDL-1-F2LG00N/A92.2PLC_105View