|
|
Marker Overview
| Name | PBA_LC_0013 |
|---|
| Genbank ID | N/A |
|---|
| Type | EST-SSR |
|---|
| Species | Lens culinaris |
|---|
| Primer 1 | PBA_LC_0013.Forward Primer: GCAGCAGCATGAGAAAATG |
|---|
| Primer 2 | PBA_LC_0013.Reverse Primer: ATTACTCGACGCCCCCTAGT |
|---|
| Publication | [view all] |
|---|
| Contact | Sukhjiwan Kaur
|
|---|
Publications
| Year | Publication |
|---|
| 2016 | Sudheesh S, Rodda MS, Davidson J, Javid M, Stephens A, Slater AT, Cogan NO, Forster JW, Kaur S. SNP-Based Linkage Mapping for Validation of QTLs for Resistance to Ascochyta Blight in Lentil. Frontiers in plant science. 2016; 7:1604. |
| 2017 | Singh A, Sharma V, Dikshit HK, Aski M, Kumar H, Thirunavukkarasu N, Patil BS, Kumar S, Sarker A. Association mapping unveils favorable alleles for grain iron and zinc concentrations in lentil (Lens culinaris subsp. culinaris). PloS one. 2017; 12(11):e0188296. |
|
