3634045, 3634045 (genetic_marker) Lens culinaris

Marker Overview
Name3634045
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesLens culinaris
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
36340453634045Lens culinarismarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lentil-LR11-F1-20181N/A03634045View
2Lentil-LR8LR11LR39Consensus-F1-20181N/A03634045View
Sequence
>3634045 ID=3634045|Name=3634045|organism=Lens culinaris|type=genetic_marker|length=69bp
TGCAGTATCCAATTTACAATCAAAAAAAGAAAAAACAAATCTTCACATAT
ATAACCATACAATTCCCTA