3636355, 3636355 (genetic_marker) Lens culinaris

Marker Overview
Name3636355
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesLens culinaris
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
36363553636355Lens culinarismarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lentil-LR11-F1-20181N/A03636355View
2Lentil-LR39-F1-20181N/A12.173636355View
3Lentil-LR8LR11LR39Consensus-F1-20181N/A03636355View
Sequence
>3636355 ID=3636355|Name=3636355|organism=Lens culinaris|type=genetic_marker|length=69bp
TGCAGTCATGAAAATAAATTTATTAGTAATAATATAACAGCCTCAACAAT
GATAATGATAACCTTTACA