4083686, 4083686 (genetic_marker) Lens culinaris

Marker Overview
Name4083686
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesLens culinaris
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
40836864083686Lens culinarismarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lentil-LR11-F1-20181N/A04083686View
2Lentil-LR8LR11LR39Consensus-F1-20181N/A04083686View
Sequence
>4083686 ID=4083686|Name=4083686|organism=Lens culinaris|type=genetic_marker|length=69bp
TGCAGTTGAGTCATCTAAACCCATTTCTGCCCATTTTCTTACAGATCGGA
AGAGCGGTTCAGCAGGAAT