4118543, 4118543 (genetic_marker) Lens culinaris

Marker Overview
Name4118543
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesLens culinaris
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
41185434118543Lens culinarismarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lentil-LR11-F1-20181N/A04118543View
2Lentil-LR8LR11LR39Consensus-F1-20181N/A04118543View
Sequence
>4118543 ID=4118543|Name=4118543|organism=Lens culinaris|type=genetic_marker|length=69bp
TGCAGGTTGGAATGGATGAGGCTTTTGGACCCGAAACCGCCCAACACGGC
CCATTGTCCAACCCTAGCC