|
Marker Overview
Name | Ca-CNMS8 |
Genbank ID | 28367413 |
Type | SSR |
Species | Cicer sp. |
Repeat Motif | (AGTTG)3 |
Primer 1 | Ca-CNMS8.Forward primer: GCTTTCCTTTCTTATGACCAC |
Primer 2 | Ca-CNMS8.Reverse primer: CATGAGGACAATGAAGTCAATA |
Product Length | 150 |
Publication | [view all] |
Contact | Swarup K. Parida
|
References
External references for this genetic_marker
Database | Accession |
DB:genbank | 28367413 |
Publications
Year | Publication |
2014 | Bajaj D, Saxena MS, Kujur A, Das S, Badoni S, Tripathi S, Upadhyaya HD, Gowda CL, Sharma S, Singh S, Tyagi AK, Parida SK. Genome-wide conserved non-coding microsatellite (CNMS) marker-based integrative genetical genomics for quantitative dissection of seed weight in chickpea. Journal of experimental botany. 2014 Dec 10. |
|