Ca-CNMS32, Ca-CNMS32 () Cicer sp.

Name	Ca-CNMS32
Genbank ID	28367014
Type	SSR
Species	Cicer sp.
Repeat Motif	(TC)6
Primer 1	Ca-CNMS32.Forward primer: AAACTGCGTCGTGTGTTT
Primer 2	Ca-CNMS32.Reverse primer: TTATGGGTTTCGTCAAAGTTA
Product Length	155
Publication	[view all]
Contact	Swarup K. Parida

Name	Details
Swarup K. Parida	First name: Swarup Last name: Parida Institution: National Institute of Plant Genome Research Address: Aruna Asaf Ali Marg, New Delhi 110067, India Country: India Email: swarup@nipgr.ac.in Last update: Apr 2018

Database	Accession
DB:genbank	28367014

Aligned Feature	Feature Type	Alignment Location
Ca1	chromosome	Ca1:10558166..10558320 .
chr1	chromosome	chr1:10558166..10558320 .

Year	Publication
2014	Bajaj D, Saxena MS, Kujur A, Das S, Badoni S, Tripathi S, Upadhyaya HD, Gowda CL, Sharma S, Singh S, Tyagi AK, Parida SK. Genome-wide conserved non-coding microsatellite (CNMS) marker-based integrative genetical genomics for quantitative dissection of seed weight in chickpea. Journal of experimental botany. 2014 Dec 10.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xICC17163-RIL	LG1	N/A	59.7	Ca-CNMS32	View