3807, 3807 (genetic_marker) Pisum sativum

Marker Overview
Name3807
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 13807.Forward: ACACGCATGCACGATTACAT
Primer 23807.Reverse: GCTTTGCACGCATGTGTAGT
Product Length182
Publication[view all]
ContactXuxiao Zong
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward3807.ForwardPisum sativumprimer
Reverse3807.ReversePisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
38073807-130.1Pisum sativummarker_locus
38073807Pisum sativummarker_locus


Contact
NameDetails
Xuxiao Zong
First name:Xuxiao
Last name:Zong
Institution:Chinese Academy of Agricultural Science
Address:Institute of Crop Sciences, The National Key Facility for Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Beijing 100081, China
Country:China
Email:zongxx@mail.caas.net.cn
Last update:Mar 2014
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-G0003973_x_Zhongwan6-F2LG-AN/A130.13807View
2Pea-G0003973_x_Zhongwan6-F2-2015LG-AN/A1613807View