|
Marker Overview
Name | BMc-063 |
Genbank ID | HO212378 |
Type | EST-SSR |
Species | Phaseolus vulgaris |
Repeat Motif | (CTT)15 |
Primer 1 | BMc-063.Forward: TTCCTTCTCCTCCTTCACCT |
Primer 2 | BMc-063.Reverse: GGCTCCTCATAGTGGTCTTCA |
Product Length | 112 |
Publication | [view all] |
Contact | Matthew Blair
|
References
External references for this genetic_marker
Database | Accession |
DB:genbank | HO212378 |
Publications
Year | Publication |
2011 | Blair MW, Hurtado N, Chavarro CM, Muñoz-Torres MC, Giraldo MC, Pedraza F, Tomkins J, Wing R. Gene-based SSR markers for common bean (Phaseolus vulgaris L.) derived from root and leaf tissue ESTs: an integration of the BMc series. BMC plant biology. 2011 Mar 22; 11:50. |
2010 | Blair MW, Medina JI, Astudillo C, Rengifo J, Beebe SE, Machado G, Graham R. QTL for seed iron and zinc concentration and content in a Mesoamerican common bean (Phaseolus vulgaris L.) population. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2010 Oct; 121(6):1059-70. |
|