BMd-001

Name	BMd-001
Genbank ID	X96999
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(AT)9
Primer 1	BMd-001.Forward: CAAATCGCAACACCTCACAA
Primer 2	BMd-001.Reverse: GTCGGAGCCATCATCTGTTT
Product Length	165
Publication	[view all]
Contact	Matthew Blair Paul Gepts
Comment	Ypr10

Name	Details
Matthew Blair	First name: Matthew Last name: Blair Institution: International Center for Tropical Agriculture Country: Colombia Email: mwblaircgiar@gmail.com Last update: Aug 2009
Paul Gepts	First name: Paul Last name: Gepts Institution: University of California, Davis Country: United States Email: plgepts@ucdavis.edu Last update: Jan 2019

Database	Accession
DB:genbank	X96999

Year	Publication
2003	Blair MW, Pedraza F, Buendia HF, Gaitán-Solís E, Beebe SE, Gepts P, Tohme J. Development of a genome-wide anchored microsatellite map for common bean (Phaseolus vulgaris L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2003 Nov; 107(8):1362-74.
2019	Gioia T, Logozzo G, Marzario S, Spagnoletti Zeuli P, Gepts P. Evolution of SSR diversity from wild types to U.S. advanced cultivars in the Andean and Mesoamerican domestications of common bean (Phaseolus vulgaris). PloS one. 2019; 14(1):e0211342.
2010	Blair MW, Medina JI, Astudillo C, Rengifo J, Beebe SE, Machado G, Graham R. QTL for seed iron and zinc concentration and content in a Mesoamerican common bean (Phaseolus vulgaris L.) population. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2010 Oct; 121(6):1059-70.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Bean-G14519/G4825-RIL	LG03	N/A	8.8	BMd1	View