BMd-008

Marker Overview
NameBMd-008
Genbank IDU70530
TypeSSR
SpeciesPhaseolus vulgaris
Repeat Motif(CT)7
Primer 1BMd-008.Forward: TTCATCCTCTCTCCCGAACTT
Primer 2BMd-008.Reverse: CTTTTGTGGCTGAGACATGGT
Product Length176
Publication[view all]
ContactMatthew Blair
CommentGibberellin 20-oxidase
References
External references for this genetic_marker
DatabaseAccession
DB:genbankU70530
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardBMd-008.ForwardPhaseolus vulgarisprimer
ReverseBMd-008.ReversePhaseolus vulgarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BMd8BMd8-20.6Phaseolus vulgarismarker_locus


Contact
NameDetails
Matthew Blair
First name:Matthew
Last name:Blair
Institution:International Center for Tropical Agriculture
Country:Colombia
Email:mwblaircgiar@gmail.com
Last update:Aug 2009
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Bean-SEQ1006/RAZ106-F2:3LG04N/A20.6BMd8View