BMd-009

Marker Overview
NameBMd-009
Genbank IDX06336
TypeSSR
SpeciesPhaseolus vulgaris
Repeat Motif(CATG)4
Primer 1BMd-009.Forward: TATGACACCACTGGCCATACA
Primer 2BMd-009.Reverse: CACTGCGACATGAGAGAAAGA
Product Length135
Publication[view all]
ContactMatthew Blair
CommentPhytohemagglutinin-L (PHA-L)
References
External references for this genetic_marker
DatabaseAccession
DB:genbankX06336
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardBMd-009.ForwardPhaseolus vulgarisprimer
ReverseBMd-009.ReversePhaseolus vulgarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BMd9BMd9-0.6Phaseolus vulgarismarker_locus


Contact
NameDetails
Matthew Blair
First name:Matthew
Last name:Blair
Institution:International Center for Tropical Agriculture
Country:Colombia
Email:mwblaircgiar@gmail.com
Last update:Aug 2009
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Bean-SEQ1006/RAZ106-F2:3LG04N/A0.6BMd9View