Pv-ag004

Marker Overview
NamePv-ag004
Genbank IDX04660
TypeSSR
SpeciesPhaseolus vulgaris
Repeat Motif(AG)8
Primer 1Pv-ag004.Forward: TGTAAACGACGGCCAGTATGCTTGATGACGTGGATGCATTGC
Primer 2Pv-ag004.Reverse: AAAGGGCTAGGGAGAGTAAGTTGG
Product Length201
Publication[view all]
ContactMatthew Blair
Paul Gepts
References
External references for this genetic_marker
DatabaseAccession
DB:genbankX04660
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardPv-ag004.ForwardPhaseolus vulgarisprimer
ReversePv-ag004.ReversePhaseolus vulgarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PVag4PVag4-0.6Phaseolus vulgarismarker_locus
Pv-ag004Pv-ag004-23.9Phaseolus vulgarismarker_locus
Pv-ag004Pv-ag004Phaseolus vulgarismarker_locus


Contact
NameDetails
Matthew Blair
First name:Matthew
Last name:Blair
Institution:International Center for Tropical Agriculture
Country:Colombia
Email:mwblaircgiar@gmail.com
Last update:Aug 2009
Paul Gepts
First name:Paul
Last name:Gepts
Institution:University of California, Davis
Country:United States
Email:plgepts@ucdavis.edu
Last update:Jan 2019
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Bean-SEQ1006/RAZ106-F2:3LG04N/A0.6PVag4View
2Bean-G14519/G4825-RILLG04N/A23.9Pv-ag004View
3Bean-Tiber/Starozagorski-IntegratedLG04N/A35.03Pv-ag004View