|
Marker Overview
Name | Pv-ag004 |
Genbank ID | X04660 |
Type | SSR |
Species | Phaseolus vulgaris |
Repeat Motif | (AG)8 |
Primer 1 | Pv-ag004.Forward: TGTAAACGACGGCCAGTATGCTTGATGACGTGGATGCATTGC |
Primer 2 | Pv-ag004.Reverse: AAAGGGCTAGGGAGAGTAAGTTGG |
Product Length | 201 |
Publication | [view all] |
Contact | Paul Gepts Matthew Blair
|
References
External references for this genetic_marker
Database | Accession |
DB:genbank | X04660 |
Publications
Year | Publication |
2019 | Gioia T, Logozzo G, Marzario S, Spagnoletti Zeuli P, Gepts P. Evolution of SSR diversity from wild types to U.S. advanced cultivars in the Andean and Mesoamerican domestications of common bean (Phaseolus vulgaris). PloS one. 2019; 14(1):e0211342. |
2010 | Blair MW, Medina JI, Astudillo C, Rengifo J, Beebe SE, Machado G, Graham R. QTL for seed iron and zinc concentration and content in a Mesoamerican common bean (Phaseolus vulgaris L.) population. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2010 Oct; 121(6):1059-70. |
|