BMb-0625s

Name	BMb-0625s
Genbank ID	N/A
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(TC)10
Primer 1	BMb-0625s.Forward: CCACCAGAGATAGACAGAGC
Primer 2	BMb-0625s.Reverse: CAGCACCGTTACACAAATTA
Product Length	280
Publication	[view all]
Contact	Matthew Blair

Name	Details
Matthew Blair	First name: Matthew Last name: Blair Institution: International Center for Tropical Agriculture Country: Colombia Email: mwblaircgiar@gmail.com Last update: Aug 2009

Year	Publication
2014	Blair MW, Córdoba JM, Muñóz C, Yuyó DK. BAC-end microsatellites from intra and inter-genic regions of the common bean genome and their correlation with cytogenetic features. PloS one. 2014; 9(9):e101873.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Bean-DOR364/G19833-RIL	LG06	N/A	0	BMb625s	View