BM-0164

Name	BM-0164
Genbank ID	N/A
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(GT)9(GA)21
Primer 1	BM-0164.Forward: CCACCACAAGGAGAAGCAAC
Primer 2	BM-0164.Reverse: ACCATTCAGGCCGATACTCC
Product Length	182
Publication	[view all]
Contact	Matthew Blair J. Tohme

Name	Details
Matthew Blair	First name: Matthew Last name: Blair Institution: International Center for Tropical Agriculture Country: Colombia Email: mwblaircgiar@gmail.com Last update: Aug 2009
J. Tohme	First name: J Last name: Tohme Institution: International Center for Tropical Agriculture Email: j.tohme@cgiar.org Last update: Nov 2002

Year	Publication
2010	Córdoba JM, Chavarro C, Schlueter JA, Jackson SA, Blair MW. Integration of physical and genetic maps of common bean through BAC-derived microsatellite markers. BMC genomics. 2010 Jul 16; 11:436.
2002	Gaitan-Solis E, Duque MC, Edwards KJ, Tohme J. Microsatellite Repeats in Common Bean (Phaseolus vulgaris): Isolation, Characterization, and Cross-Species Amplification in Phaseolus ssp.. Crop Science. 2002; 42:2128-2136.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Bean-DOR364/G19833-RIL-2010	LG02	N/A	10.7	BM164	View
2	Bean-PMB0225/PHA1037-RIL	LG02	N/A	0	BM164	View
3	Bean-CAL143/IAC-UNA-RIL	LG02-1	N/A	94.9	BM164	View
4	Bean-Tiber/Starozagorski-Integrated	LG02	N/A	175.9	BM164	View
5	Bean-Tiber/Starozagorski-RIL	LG02	N/A	201.55	BM164	View
6	Bean-Beluga/PHA0399-RIL	LG02	N/A	136.81	BM164	View
7	Bean-Gonzalez_consensus_map-2016	LG02	N/A	130.96	BM164	View
8	Bean-PHA0419/Beluga-RIL	LG02	N/A	127.71	BM164	View
9	Bean-PMB0225/PHA1037-RIL-2015	LG02	N/A	67.9	BM164	View
10	Bean-Cerinza/G10022-BC2	LG02	N/A	30.6	BM164	View
11	Bean-Cerinza/G10022-BC2-2012	LG02	N/A	31.3	BM164	View
12	Bean-DOR364/G19833-RIL-2008	LG02	N/A	56.3	BM164	View