BM-0200

Marker Overview
NameBM-0200
Genbank IDN/A
TypeSSR
SpeciesPhaseolus vulgaris
Repeat Motif(AG)10
Primer 1BM-0200.Forward: TGGTGGTTGTTATGGGAGAAG
Primer 2BM-0200.Reverse: ATTTGTCTCTGTCTATTCCTTCCAC
Product Length221
Publication[view all]
ContactMatthew Blair
J. Tohme
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Anthracnose severity - petioleqANSP.PMB0225/PHA1037.LG01.race:1545Phaseolus vulgarisQTL
Anthracnose disease score - petioleqANDP.PMB0225/PHA1037.LG01.race:1545Phaseolus vulgarisQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ReverseBM-0200.ReversePhaseolus vulgarisprimer
ForwardBM-0200.ForwardPhaseolus vulgarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BM200BM200-137.2Phaseolus vulgarismarker_locus
BM200BM200-49.9Phaseolus vulgarismarker_locus
BM200BM200-95.6Phaseolus vulgarismarker_locus
BM200BM200-90.8Phaseolus vulgarismarker_locus


Contact
NameDetails
Matthew Blair
First name:Matthew
Last name:Blair
Institution:International Center for Tropical Agriculture
Country:Colombia
Email:mwblaircgiar@gmail.com
Last update:Aug 2009
J. Tohme
First name:J
Last name:Tohme
Institution:International Center for Tropical Agriculture
Email:j.tohme@cgiar.org
Last update:Nov 2002
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Bean-DOR364/G19833-RIL-2008LG01N/A137.2BM200-137.2View
2Bean-PMB0225/PHA1037-RIL-2015LG01N/A49.9BM200-49.9View
3Bean-PMB0225/PHA1037-RILLG01-1N/A95.6BM200-95.6View
4Bean-DOR364/G19833-RIL-2010LG01N/A90.8BM200-90.8View