BMd-0045

Marker Overview
NameBMd-0045
Genbank IDAF293023
TypeSSR
SpeciesPhaseolus vulgaris
Repeat Motif(AG)5
Primer 1BMd-0045.Forward: GGTTGGGAAGCCTCATACAG
Primer 2BMd-0045.Reverse: ATCTTCGACCCACCTTGCT
Product Length129
Publication[view all]
ContactMatthew Blair
CommentIAA-protein conjugate
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAF293023
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardBMd-0045.ForwardPhaseolus vulgarisprimer
ReverseBMd-0045.ReversePhaseolus vulgarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BMd45BMd45-58.2Phaseolus vulgarismarker_locus
BMd045BMd045-56.01Phaseolus vulgarismarker_locus
BMd045BMd045-73.17Phaseolus vulgarismarker_locus
BMd045BMd045-62.74Phaseolus vulgarismarker_locus
BMd045BMd045-56.3Phaseolus vulgarismarker_locus
BMd45BMd45Phaseolus vulgarismarker_locus


Contact
NameDetails
Matthew Blair
First name:Matthew
Last name:Blair
Institution:International Center for Tropical Agriculture
Country:Colombia
Email:mwblaircgiar@gmail.com
Last update:Aug 2009
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Bean-DOR364/G19833-RIL-2010LG01N/A58.2BMd45View
2Bean-Beluga/PHA0399-RILLG01N/A56.01BMd045View
3Bean-Gonzalez_consensus_map-2016LG01N/A73.17BMd045View
4Bean-PHA0419/Beluga-RILLG01N/A62.74BMd045View
5Bean-DOR364/G19833-RIL-2008LG01N/A56.3BMd045View
6Bean-Tiber/Starozagorski-IntegratedLG01N/A152.03BMd45View