
Marker Overview
Genbank IDN/A
SpeciesPhaseolus vulgaris
Repeat Motif(CT)7
Primer 1BMarc-0016.Forward: TCATGCATTAACCATCACTC
Primer 2BMarc-0016.Reverse: GCCATCGTTGCTTAATTCT
Product Length144
Publication[view all]
ContactMatthew Blair

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardBMarc-0016.ForwardPhaseolus vulgarisprimer
ReverseBMarc-0016.ReversePhaseolus vulgarisprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BMarc16BMarc16-0.6Phaseolus vulgarismarker_locus

Matthew Blair
First name:Matthew
Last name:Blair
Institution:International Center for Tropical Agriculture
Last update:Aug 2009
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer