BMarc-0017

Marker Overview
NameBMarc-0017
Genbank IDN/A
TypeSSR
SpeciesPhaseolus vulgaris
Repeat Motif(AATT)3
Primer 1BMarc-0017.Forward: CTTCTGAGCTGAAGTAAAACG
Primer 2BMarc-0017.Reverse: AGTGAGACAGAAAGGCAAAT
Product Length246
Publication[view all]
ContactMatthew Blair
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardBMarc-0017.ForwardPhaseolus vulgarisprimer
ReverseBMarc-0017.ReversePhaseolus vulgarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BMarc17BMarc17-0.6Phaseolus vulgarismarker_locus


Contact
NameDetails
Matthew Blair
First name:Matthew
Last name:Blair
Institution:International Center for Tropical Agriculture
Country:Colombia
Email:mwblaircgiar@gmail.com
Last update:Aug 2009
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Bean-SEQ1006/RAZ106-F2:3LG04N/A0.6BMarc17View