|
|
Marker Overview
| Name | ATA-0076 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Phaseolus vulgaris |
|---|
| Repeat Motif | (TAA)12(N)29(TA)8 |
|---|
| Primer 1 | ATA-0076.Forward: GATCTAATTTTTTGCTTCTT |
|---|
| Primer 2 | ATA-0076.Reverse: TGCTATTATATTCCTTTTCA |
|---|
| Product Length | 198 |
|---|
| Max Length | 220 |
|---|
| Publication | [view all] |
|---|
| Contact | Matthew Blair
Matthew W. Blair
|
|---|
Publications
| Year | Publication |
|---|
| 2010 | Blair MW, Medina JI, Astudillo C, Rengifo J, Beebe SE, Machado G, Graham R. QTL for seed iron and zinc concentration and content in a Mesoamerican common bean (Phaseolus vulgaris L.) population. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2010 Oct; 121(6):1059-70. |
| 2008 | Blair MW, Buendia HF, Giraldo MC, Metais I, Peltier D. Characterization of AT-rich microsatellites in common bean (Phaseolus vulgaris L.). Theor Appl Genet. 2008; 118:91-103. |
|
