SSR-IAC006

Name	SSR-IAC006
Genbank ID	N/A
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(TA)7
Primer 1	SSR-IAC006.Forward: CCGGCTCCTGCTGACG
Primer 2	SSR-IAC006.Reverse: ATGTTCTGCCTTTCGCTCCTT
Product Length	187
Max Length	190
Publication	[view all]
Contact	Marta Santalla Luciana Benchimol

Name	Details
Marta Santalla	First name: Marta Last name: Santalla Institution: Mision Biologica de Galicia-Consejo Superior de Investigaciones Cientificas Country: Spain Email: msantalla@mbg.csic.es Last update: Dec 2016
Luciana Benchimol	First name: Luciana Last name: Benchimol Institution: Gouvea Centro de Pesquisa e Desenvolvimento de Recursos Geneticos Vegetais Country: Brazil Email: llasry@iac.sp.gov.br Last update: Apr 2007

Year	Publication
2016	González AM, Yuste-Lisbona FJ, Saburido S, Bretones S, De Ron AM, Lozano R, Santalla M. Major Contribution of Flowering Time and Vegetative Growth to Plant Production in Common Bean As Deduced from a Comparative Genetic Mapping. Frontiers in plant science. 2016; 7:1940.
2007	Benchimol LL, deCampos T, Carbonell SAM, Colombo CA, Chioratto AF, Formighieri EF, Gouvea LRL, deSouza AP. Structure of genetic diversity among common bean (Phaseolus vulgaris L.) varieties of Mesoamerican and Andean origins using new developed microsatellite markers. Genet Resour Crop Evol. 2007; 54:1747-1762.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Bean-Beluga/PHA0399-RIL	LG02	N/A	0	IAC006	View
2	Bean-Gonzalez_consensus_map-2016	LG02	N/A	0	IAC006	View
3	Bean-PHA0419/Beluga-RIL	LG02	N/A	0	IAC006	View
4	Bean-CAL143/IAC-UNA-RIL	LG07	N/A	257.9	IAC06	View
5	Bean-Tiber/Starozagorski-Integrated	LG02	N/A	22.52	SSR-IAC6	View
6	Bean-Tiber/Starozagorski-RIL	LG02	N/A	117.24	SSR-IAC6	View