|
|
Marker Overview
| Name | SSR-IAC076 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Phaseolus vulgaris |
|---|
| Repeat Motif | (TA)10 (TG)7 (TA)4 |
|---|
| Primer 1 | SSR-IAC076.Forward: TTCATGGCCAATAATCAGG |
|---|
| Primer 2 | SSR-IAC076.Reverse: GAGAAAATTCAGAGGGTAGATG |
|---|
| Product Length | 191 |
|---|
| Max Length | 205 |
|---|
| Publication | [view all] |
|---|
| Contact | Marta Santalla
Luciana Benchimol
|
|---|
Publications
| Year | Publication |
|---|
| 2016 | González AM, Yuste-Lisbona FJ, Saburido S, Bretones S, De Ron AM, Lozano R, Santalla M. Major Contribution of Flowering Time and Vegetative Growth to Plant Production in Common Bean As Deduced from a Comparative Genetic Mapping. Frontiers in plant science. 2016; 7:1940. |
| 2007 | Benchimol LL, deCampos T, Carbonell SAM, Colombo CA, Chioratto AF, Formighieri EF, Gouvea LRL, deSouza AP. Structure of genetic diversity among common bean (Phaseolus vulgaris L.) varieties of Mesoamerican and Andean origins using new developed microsatellite markers. Genet Resour Crop Evol. 2007; 54:1747-1762. |
|
