VM-026

Name	VM-026
Genbank ID	N/A
Type	SSR
Species	Vigna unguiculata
Repeat Motif	(TC)14
Primer 1	VM-026.Forward: GGCATCAGACACATATCACTG
Primer 2	VM-026.Reverse: TGTGGCATTGAGGGTAGC
Product Length	294
Publication	[view all]
Contact	Guojing Li Graham Scoles

Name	Details
Guojing Li	First name: Guojing Last name: Li Institution: Zhejiang Academy of Agricultural Sciences Address: Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China Country: China Email: guojing_li@yahoo.com.cn Last update: Jan 2011
Graham Scoles	First name: Graham Last name: Scoles Institution: University of Saskatchewan Country: Canada Email: graham.scoles@usask.ca Last update: Jan 2001

Year	Publication
2011	Xu P, Wu X, Wang B, Liu Y, Ehlers JD, Close TJ, Roberts PA, Diop NN, Qin D, Hu T, Lu Z, Li G. A SNP and SSR based genetic map of asparagus bean (Vigna. unguiculata ssp. sesquipedialis) and comparison with the broader species. PloS one. 2011 Jan 06; 6(1):e15952.
2001	Li CD, Fatokun CA, Ubi B, Singh BB, Scoles GJ. Determining Genetic Similarities and Relationships among Cowpea Breeding Lines and Cultivars by Microsatellite Markers. Crop Science. 2001; 41:189-197.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cowpea-ZN016/Zhijiang-282-RIL	LG10	N/A	47.28	VM26	View
2	Cowpea-Sanzi/Vita7-F10-RIL	LG01	N/A	473.9	VM26	View