BARC-PV_1.0_Chr01_6035647_G_T

Marker Overview
NameBARC-PV_1.0_Chr01_6035647_G_T
AliasBARCPV_1.0_Chr01_6035647_G_T
715639795
ss715639795
dbSNP ID715639795
SNP Array ID
BARCBean6K_2:BARC-PV_1.0_Chr01_6035647_G_T
BARCBean6K_3:BARC-PV_1.0_Chr01_6035647_G_T
TypeSNP
SNP AllelesG/T
5' Flanking SequenceTCTATCATTATTGAGTGGGAGCGGGTGAATTCCCTATGTTTTTAGTCATTATTTCTGAGC
3' Flanking SequenceGAACTAAATGATCAACTCGCTTATCTTGTTCAATTCTGATGTATTTTTTCAGGAAACATG
SpeciesPhaseolus vulgaris
Publication[view all]
ContactQijian Song
References
External references for this genetic_marker
DatabaseAccession
dbSNP715639795
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BARCPV_1.0_Chr01_6035647_G_TBARCPV_1.0_Chr01_6035647_G_T-20.99Phaseolus vulgarismarker_locus
BARC-PV_1.0_Chr01_6035647_G_TBARC-PV_1.0_Chr01_6035647_G_TPhaseolus vulgarismarker_locus
ss715639795ss715639795Phaseolus vulgarismarker_locus


Contact
NameDetails
Qijian Song
First name:Qijian
Last name:Song
Institution:USDA-ARS
Address:Beltsville, Maryland 20705
Country:United States
Email:Qijian.Song@ars.usda.gov
Last update:Aug 2015
Libraries
Library NameType
BARCBean6K_2SNP_chip
BARCBean6K_3SNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Bean-Stampede/RedHawk-F2LG01N/A20.99BARCPV_1.0_Chr01_6035647_G_T-20.99View
2Bean-Ruda/AND277-F10LG01N/A85.7BARC-PV_1.0_Chr01_6035647_G_TView
3Bean-CAL96/[MLB-49-89A]-RILLG01N/A26.31ss715639795View
Sequence
>BARC-PV_1.0_Chr01_6035647_G_T ID=BARC-PV_1.0_Chr01_6035647_G_T|Name=BARC-PV_1.0_Chr01_6035647_G_T|organism=Phaseolus vulgaris|type=genetic_marker|length=121bp
TCTATCATTATTGAGTGGGAGCGGGTGAATTCCCTATGTTTTTAGTCATT
ATTTCTGAGCKGAACTAAATGATCAACTCGCTTATCTTGTTCAATTCTGA
TGTATTTTTTCAGGAAACATG