CcM00370

Name	CcM00370
Genbank ID	FI198857
Type	SSR
Species	Cajanus cajan
Repeat Motif	(AT)26
Primer 1	CcM00370.Forward: TGGTCCAACATCAATAGCAAA
Primer 2	CcM00370.Reverse: TGATGATGACCGAGGGGT
Product Length	278
Publication	[view all]
Contact	Douglas Cook

Name	Details
Douglas Cook	First name: Douglas Last name: Cook Institution: University of California, Davis Country: United States Email: drcook@ucdavis.edu Last update: Mar 2011

Database	Accession
DB:genbank	FI198857

Year	Publication
2011	Bohra A, Dubey A, Saxena RK, Penmetsa RV, Poornima KN, Kumar N, Farmer AD, Srivani G, Upadhyaya HD, Gothalwal R, Ramesh S, Singh D, Saxena K, Kishor PBK, Singh NK, Town CD, May GD, Cook DR, Varshney RK. Analysis of BAC-end sequences (BESs) and development of BES-SSR markers for genetic mapping and hybrid purity assessment in pigeonpea (Cajanus spp.). BMC Plant Biology. 2011; 11:56.