PsCam004787

Marker Overview
NamePsCam004787
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam004787
TypeSNP
SNP AllelesT/C
5' Flanking SequenceGGAACAAGTGTTGGATTTCCCTGATAAAAAGAATAATTATTCAAAGAGGAGATTACAATC
3' Flanking SequenceATGTTATAGACTATAGTCTTCTAATTCACAATCAAAAGAATCATGCATTCAAAGTACTAC
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam004787_3611_167PsCam004787_3611_167Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Cameor_x_Melrose-RILLG01N/A0.8PsCam004787_3611_167View
2Pea-Cerise_x_Cameor-F3LG01N/A0.8PsCam004787_3611_167View
3Pea-Champagne_x_Terese-RILLG01N/A3.2PsCam004787_3611_167View
4Pea-Consensus_GenoPea_array-2015LG01N/A0.7PsCam004787_3611_167View
5Pea-Kazar_x_Cameor-RILLG01N/A0.8PsCam004787_3611_167View
6Pea-Sommette_x_Cameor-RILLG01N/A1.6PsCam004787_3611_167View
7Pea-002067/Reward-F8-RILLG01N/A205.51PsCam004787_3611_167View
Sequence
>PsCam004787 ID=PsCam004787|Name=PsCam004787|organism=Pisum sativum|type=genetic_marker|length=121bp
GGAACAAGTGTTGGATTTCCCTGATAAAAAGAATAATTATTCAAAGAGGA
GATTACAATCYATGTTATAGACTATAGTCTTCTAATTCACAATCAAAAGA
ATCATGCATTCAAAGTACTAC