PsCam005384

Marker Overview
NamePsCam005384
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam005384
TypeSNP
SNP AllelesT/G
5' Flanking SequenceACTGCACAATGAACATGAAACCTACACAAAAATGCCAAAAGTCTGCAATGTGAAATACCA
3' Flanking SequenceATAGCATTGCGGATAAATAGCGGAAACCGCATAGCGATTGCAGTAACGCATGTTGCATAC
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam005384_4084_1303PsCam005384_4084_1303Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Champagne_x_Terese-RILLG01N/A36PsCam005384_4084_1303View
2Pea-Consensus_GenoPea_array-2015LG01N/A40.5PsCam005384_4084_1303View
3Pea-JI296_x_DP-RILLG01N/A40.6PsCam005384_4084_1303View
4Pea-Kazar_x_Cameor-RILLG01N/A27.7PsCam005384_4084_1303View
5Pea-Kazar_x_Melrose-RILLG01N/A27.5PsCam005384_4084_1303View
Sequence
>PsCam005384 ID=PsCam005384|Name=PsCam005384|organism=Pisum sativum|type=genetic_marker|length=121bp
ACTGCACAATGAACATGAAACCTACACAAAAATGCCAAAAGTCTGCAATG
TGAAATACCAKATAGCATTGCGGATAAATAGCGGAAACCGCATAGCGATT
GCAGTAACGCATGTTGCATAC