PsCam034768

Marker Overview
NamePsCam034768
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam034768
TypeSNP
SNP AllelesA/G
5' Flanking SequenceATAGTGGTCCCCGTGGCATACTACTTCTTCCTTCAGTATATGGGTTCAAATGCTAGCCTT
3' Flanking SequenceTAAGGTTTTGGTGCATGTGGGGATATTCTCTTTCCATTTTCATCATCTCTTCGGTAAGTT
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam034768_20132_1067PsCam034768_20132_1067Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Consensus_GenoPea_array-2015LG01N/A26.8PsCam034768_20132_1067View
2Pea-Kazar_x_Cameor-RILLG01N/A19.4PsCam034768_20132_1067View
3Pea-Kazar_x_Melrose-RILLG01N/A13.5PsCam034768_20132_1067View
4Pea-Sommette_x_Cameor-RILLG01N/A31.3PsCam034768_20132_1067View
Sequence
>PsCam034768 ID=PsCam034768|Name=PsCam034768|organism=Pisum sativum|type=genetic_marker|length=121bp
ATAGTGGTCCCCGTGGCATACTACTTCTTCCTTCAGTATATGGGTTCAAA
TGCTAGCCTTRTAAGGTTTTGGTGCATGTGGGGATATTCTCTTTCCATTT
TCATCATCTCTTCGGTAAGTT