PsCam038559

Marker Overview
NamePsCam038559
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam038559
TypeSNP
SNP AllelesA/G
5' Flanking SequenceGAAGAAGAGGATTTTATGGTTAATACTCATTAAATGATTCCAAACTTTTTTTGGAGTGAT
3' Flanking SequenceCAATCCCGAAGAGCATGTAAAATGGAATCCGGTTGAACACCACATATGTCACAAACGTTG
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam038559_23581_749PsCam038559_23581_749Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Baccara_x_PI180693-RILLG04N/A32.6PsCam038559_23581_749View
2Pea-Cameor_x_Melrose-RILLG04N/A22.8PsCam038559_23581_749View
3Pea-Cerise_x_Cameor-F3LG04N/A19.5PsCam038559_23581_749View
4Pea-Kazar_x_Cameor-RILLG04N/A31.6PsCam038559_23581_749View
5Pea-Kazar_x_Melrose-RILLG01N/A13.5PsCam038559_23581_749View
6Pea-Sommette_x_Cameor-RILLG04N/A35.5PsCam038559_23581_749View
Sequence
>PsCam038559 ID=PsCam038559|Name=PsCam038559|organism=Pisum sativum|type=genetic_marker|length=121bp
GAAGAAGAGGATTTTATGGTTAATACTCATTAAATGATTCCAAACTTTTT
TTGGAGTGATRCAATCCCGAAGAGCATGTAAAATGGAATCCGGTTGAACA
CCACATATGTCACAAACGTTG