|
|
Marker Overview
| Name | Ca-II-SSR0133 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Cicer arietinum |
|---|
| Repeat Motif | (TA)19 |
|---|
| Primer 1 | Ca-II-SSR0133.Forward: TGGATCCACAACACGACAAT |
|---|
| Primer 2 | Ca-II-SSR0133.Reverse: TCCCTTTAAGCGCAGAAAAC |
|---|
| Publication | [view all] |
|---|
| Contact | Swarup Parida
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Bajaj D, Upadhyaya HD, Khan Y, Das S, Badoni S, Shree T, Kumar V, Tripathi S, Gowda CLL, Singh S, Sharma S, Tyagi AK, Chattopdhyay D, Parida SK. A combinatorial approach of comprehensive QTL-based comparative genome mapping and transcript profiling identified a seed weight-regulating candidate gene in chickpea. Scientific Reports. 2015; 5:9264. |
|
