PUT-187a-Lens_culinaris-1099_5

Name	PUT-187a-Lens_culinaris-1099_5
Genbank ID	N/A
Type	ISM
Species	Lens culinaris
Primer 1	PUT-187a-Lens_culinaris-1099_5.Forward: TGCGCCTGTAGACCCAATTGCACCA
Primer 2	PUT-187a-Lens_culinaris-1099_5.Reverse: TCTGGTGCTGGCCCACCAAATGCC
Publication	[view all]
Contact	Debjyoti Gupta

Name	Details
Debjyoti Gupta	First name: Debjyoti Last name: Gupta Institution: ICAR-Institute of Pulses Research Country: India Email: debjyoti.gupta@icar.gov.in Last update: Oct 2017

Year	Publication
2017	Gupta DS, Kumar J, Gupta S, Dubey S, Gupta P, Singh NP, Sablok G. Identification, development, and application of cross-species intron-spanning markers in lentil (Lens culinaris Medik.). The Crop Journal. 2017; .