dou_TRINITY_DN60365_c1_g1:1413-1513

Name	dou_TRINITY_DN60365_c1_g1:1413-1513
Genbank ID	N/A
SNP Array ID	Faba_bean_130K: dou_TRINITY_DN60365_c1_g1:1413-1513
Type	TNGS
Probe 1	dou_TRINITY_DN60365_c1_g1:1413-1513.Probe: CCTAGGTGATGTACATGTCATGGCCACATGGATAGTGGCATTTTTTTGTTGTTGGGCTCTTCTTCACTCTGCAAATTTTATTTTATTCTATTGAATTTAT
Species	Vicia faba
Publication	[view all]
Contact	Xuxiao Zong

The following probe feature(s) are associated with this genetic_marker:

Feature Name	Unique Name	Species	Type
Probe	dou_TRINITY_DN60365_c1_g1:1413-1513.Probe	Vicia faba	probe

Year	Publication
2021	Wang C, Liu R, Liu Y, Hou W, Wang X, Miao Y, He Y, Ma Y, Li G, Wang D, Ji Y, Zhang H, Li M, Yan X, Zong X, Yang T. Development and application of the Faba_bean_130K targeted next-generation sequencing SNP genotyping platform based on transcriptome sequencing.. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2021 Jun 12.

Name	Details
Xuxiao Zong	First name: Xuxiao Last name: Zong Institution: Chinese Academy of Agricultural Science Address: Institute of Crop Sciences, The National Key Facility for Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Beijing 100081, China Country: China Email: zongxx@mail.caas.net.cn Last update: Mar 2014

Library Name	Type
Faba_bean_130K	SNP_chip