dou_TRINITY_DN60365_c1_g1:1413-1513

Marker Overview
Namedou_TRINITY_DN60365_c1_g1:1413-1513
Genbank IDN/A
SNP Array ID
Faba_bean_130K:dou_TRINITY_DN60365_c1_g1:1413-1513
TypeTNGS
Probe 1dou_TRINITY_DN60365_c1_g1:1413-1513.Probe: CCTAGGTGATGTACATGTCATGGCCACATGGATAGTGGCATTTTTTTGTTGTTGGGCTCTTCTTCACTCTGCAAATTTTATTTTATTCTATTGAATTTAT
SpeciesVicia faba
Publication[view all]
ContactXuxiao Zong
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
Probedou_TRINITY_DN60365_c1_g1:1413-1513.ProbeVicia fabaprobe


Contact
NameDetails
Xuxiao Zong
First name:Xuxiao
Last name:Zong
Institution:Chinese Academy of Agricultural Science
Address:Institute of Crop Sciences, The National Key Facility for Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Beijing 100081, China
Country:China
Email:zongxx@mail.caas.net.cn
Last update:Mar 2014
Libraries
Library NameType
Faba_bean_130KSNP_chip