|
Marker Overview
Name | Ca6EF10509893 |
dbSNP ID | N/A |
Type | SNP |
SNP Alleles | N/A |
Species | Cicer arietinum |
Primer 1 | Ca6EF10509893.Forward: CTCCACACACTTATCGTCAA |
Primer 2 | Ca6EF10509893.Reverse: AAATGTCATGCATCCTATGTTAGT |
Publication | [view all] |
Contact | Rajeev Varshney
|
Publications
Year | Publication |
2021 | Manchikatla PK, Kalavikatte D, Mallikarjuna BP, Palakurthi R, Khan AW, Jha UC, Bajaj P, Singam P, Chitikineni A, Varshney RK, Thudi M. MutMap Approach Enables Rapid Identification of Candidate Genes and Development of Markers Associated With Early Flowering and Enhanced Seed Size in Chickpea (Cicer arietinum L.).. Frontiers in plant science. 2021; 12:688694. |
|