CEDG111

Name	CEDG111
Genbank ID	N/A
Type	SSR
Species	Vigna angularis
Primer 1	CEDG111.Forward: TGGAAGTTTCCAAGAGGGTTTTC
Primer 2	CEDG111.Reverse: TCTCACCACCTTTTACCTTCTCA
Publication	[view all]

Feature Name	Type	Location	Analysis	Reference
Chr05	supercontig	Chr05:33252192..33252374 .	Phaseolus vulgaris G19833 genome v2.1	PCD marker alignment to genome using primer sequences
Vu05	supercontig	Vu05:41268744..41268962 .	Vigna unguiculata L. Walp IT97K-499-35 genome v1.1	PCD marker alignment to genome using primer sequences
NW_014543269.1	chromosome	NW_014543269.1:29256..29444 .	Vigna radiata cv. VC1973A genome v6.0	PCD marker alignment to genome using primer sequences
Chr_5-CM003375.1	supercontig	Chr_5-CM003375.1:23285654..23285857 .	Vigna angularis Jingnong 6 genome v1.1	PCD marker alignment to genome using primer sequences
Chr05_WLD	supercontig	Chr05_WLD:35754765..35754949 .	Phaseolus acutifolius acc. W6 15578 genome v2.0	PCD marker alignment to genome using primer sequences

Year	Publication
2004	Wang XW, Kaga A, Tomooka N, Vaughan DA. The development of SSR markers by a new method in plants and their application to gene flow studies in azuki bean [Vigna angularis (Willd.) Ohwi & Ohashi]. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2004 Jul; 109(2):352-60.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Mungbean-JP211874/JP229096-BC1F1	LG7	N/A	22.3	CEDG111	View
2	Blackgram-MDU1/TU68-F2	LG7	N/A	22.3	CEDG111	View