CD858785

EST Overview
NameCD858785
Unique NameCD858785
TypeEST
OrganismPisum sativum (pea)
Sequence length154
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Pisum sativum unigene v12010-12-27
Libraries
Library NameType
LIBEST_013997 CIcdna_library
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Pisum sativum unigene v1Pisum sativum unigene v1EST
Properties
Property NameValue
Singlet in analysisPisum sativum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>CD858785 ID=CD858785|Name=CD858785|organism=Pisum sativum|type=EST|length=154bp
GCTTCTTCATTTTCCGTTACCTTAACCACCAAAATCCCCAAAATCACTTC
TTCAACCCACCACAAATCCCATAATTCCCAAATTACCCATCTCCGATTCA
AACCTTCCCCTATTCGCACCCTCCTTCACTTCACACACAAACCAATTAGC
CTCC
back to top