U74094

EST Overview
NameU74094
Unique NameU74094
TypeEST
OrganismPisum sativum (pea)
Sequence length243
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Pisum sativum unigene v12010-12-27
Pisum sativum unigene v22011-03-01
InterProScan analysis for Pisum sativum unigene v22011-04-27
InterProScan analysis for Pisum sativum unigene v12010-12-29
Libraries
Library NameType
LIBEST_000542 Pisum sativum (J.S.Day)cdna_library
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Pisum sativum unigene v2Pisum sativum unigene v2EST
Pisum sativum unigene v1Pisum sativum unigene v1EST
InterPro
Analysis Name: InterProScan analysis for Pisum sativum unigene v2
Date Performed: 2011-04-27
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 6..17
score

Analysis Name: InterProScan analysis for Pisum sativum unigene v1
Date Performed: 2010-12-29
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 6..17
score

Properties
Property NameValue
Singlet in analysisPisum sativum unigene v2
Singlet in analysisPisum sativum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>U74094 ID=U74094|Name=U74094|organism=Pisum sativum|type=EST|length=243bp
TGGTTTCAGAACCGACAGGAATTAACAGCTGTTCTTCTCGCGACATCCTC
ATGGGATNTTTGGATGCGCCGAGAAAACACGNNTGTTATGGGTCACACCN
NTGACGTCTGAGATTCTTACNNCAGAGGTTGGGGGAAACAACACCTCCTT
GCCATCTGCTAGCATCACAACGTTNNACCTGTAAGGAACAACCTTGNTTG
AAACATACGGGACAGGATGCCGCTGGCTTAATCACGAGATCTG
back to top