CakTSSR00036, CakTSSR00036 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	CakTSSR00036
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	ICCV2
Repeat Motif	(GGT)6
Primer 1	CakTSSR00036.Forward primer: AGAGGTCTTGAAGAGGATCTG
Primer 2	CakTSSR00036.Reverse primer: CAACATCAATTCATTCCAAGT
Product Length	150
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca3	chromosome	Ca3:37362052..37362201 .
chr3	chromosome	chr3:37362052..37362201 .

Publications


Year	Publication
2012	Agarwal G, Jhanwar S, Priya P, Singh VK, Saxena MS, Parida SK, Garg R, Tyagi AK, Jain M. Comparative analysis of kabuli chickpea transcriptome with desi and wild chickpea provides a rich resource for development of functional markers. PloS one. 2012; 7(12):e52443.

Germplasm


Stock Name	Type
ICCV2	accession