CakTSSR01225, CakTSSR01225 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	CakTSSR01225
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	ICCV2
Repeat Motif	(GGT)5
Primer 1	CakTSSR01225.Forward primer: TACAATAGAAGCAGTGGTGGT
Primer 2	CakTSSR01225.Reverse primer: ACACTAATCTCTCCAGTTTCC
Product Length	177
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Ca6	chromosome	Ca6:58254917..58255093 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
chr6	chromosome	chr6:58254917..58255093 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2012	Agarwal G, Jhanwar S, Priya P, Singh VK, Saxena MS, Parida SK, Garg R, Tyagi AK, Jain M. Comparative analysis of kabuli chickpea transcriptome with desi and wild chickpea provides a rich resource for development of functional markers. PloS one. 2012; 7(12):e52443.

Germplasm


Stock Name	Type
ICCV2	accession