CaM0461, CaM0461 (genetic_marker) Cicer arietinum

Name	CaM0461
Genbank ID	EI856866
Type	SSR
Species	Cicer arietinum
Germplasm	ICC4958
Repeat Motif	(A)12n(TA)7
Primer 1	CaM0461.Forward primer: ATGGCCCATCTATCCAATGA
Primer 2	CaM0461.Reverse primer: TTGTCGTCCAATCCTACCAAG
Product Length	159
Publication	[view all]

Database	Accession
DB:genbank	EI856866

Year	Publication
2011	Thudi M, Bohra A, Nayak SN, Varghese N, Shah TM, Penmetsa RV, Thirunavukkarasu N, Gudipati S, Gaur PM, Kulwal PL, Upadhyaya HD, Kavikishor PB, Winter P, Kahl G, Town CD, Kilian A, Cook DR, Varshney RK. Novel SSR markers from BAC-end sequences, DArT arrays and a comprehensive genetic map with 1,291 marker loci for chickpea (Cicer arietinum L.). PloS one. 2011; 6(11):e27275.

Stock Name	Type
ICC4958	accession