CaM0832, CaM0832 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	CaM0832
Genbank ID	EI865429
Type	SSR
Species	Cicer arietinum
Germplasm	ICC4958
Repeat Motif	(TTC)5
Primer 1	CaM0832.Forward primer: CCAGATTGGTGGTGAATCAG
Primer 2	CaM0832.Reverse primer: ATTGGGCAATGACAAAGGAA
Product Length	211
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	EI865429

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Ca6	chromosome	Ca6:37449091..37449301 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
chr6	chromosome	chr6:37449091..37449301 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2011	Thudi M, Bohra A, Nayak SN, Varghese N, Shah TM, Penmetsa RV, Thirunavukkarasu N, Gudipati S, Gaur PM, Kulwal PL, Upadhyaya HD, Kavikishor PB, Winter P, Kahl G, Town CD, Kilian A, Cook DR, Varshney RK. Novel SSR markers from BAC-end sequences, DArT arrays and a comprehensive genetic map with 1,291 marker loci for chickpea (Cicer arietinum L.). PloS one. 2011; 6(11):e27275.

Germplasm


Stock Name	Type
ICC4958	accession