|
|
Marker Overview
| Name | CaSSR4 |
|---|
| Genbank ID | Forward Primer |
|---|
| Type | STMS |
|---|
| Species | Cicer arietinum |
|---|
| Germplasm | Pusa362 |
|---|
| Repeat Motif | (CAA)A(CAA)4G(CAA)4G(CAA) |
|---|
| Primer 1 | CaSSR4.Forward primer: ATAGTGGCATATTGGGGAGA |
|---|
| Primer 2 | CaSSR4.Reverse primer: TGAAACCCTAGAGTGGTTGTT |
|---|
| Product Length | 187 |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | Forward Primer |
Publications
| Year | Publication |
|---|
| 2006 | Choudhary S, Sethy NK, Shokeen B, Bhatia S. Development of sequence-tagged microsatellite site markers for chickpea (Cicer arietinum L.) Molecular Ecology Notes 2006 6(1):93–95. |
| 2015 | Das S, Upadhyaya HD, Bajaj D, Kujur A, Badoni S, Kumar LV, Tripathi S, Gowda CLL, Sharma S, Singh S, Tyagi AK, Parida SK. Deploying QTL-seq for rapid delineation of a potential candidate gene underlying major trait-associated QTL in chickpea. 2015; 22(3):193-203. |
|
