CaTSSR00349, CaTSSR00349 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	CaTSSR00349
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	ICC4958
Repeat Motif	(TAA)7
Primer 1	CaTSSR00349.Forward primer: CGCATCTTCAATTCCATCCT
Primer 2	CaTSSR00349.Reverse primer: GGGCCCAACTCAAAAGTTTC
Product Length	159
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Ca3	chromosome	Ca3:29594640..29594799 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
chr3	chromosome	chr3:29594640..29594799 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2012	Jhanwar S, Priya P, Garg R, Parida SK, Tyagi AK, Jain M. Transcriptome sequencing of wild chickpea as a rich resource for marker development. Plant biotechnology journal. 2012 Aug; 10(6):690-702.

Germplasm


Stock Name	Type
ICC4958	accession