GA105, GA105 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	GA105
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(GAAAAGAAA)2(GA)9
Primer 1	GA105.Forward primer: TGAGGAAACACAAAACGACG
Primer 2	GA105.Reverse primer: ATGCCAGGATTAACAGCACC
Product Length	168
Publication	[view all]

Publications


Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Germplasm


Stock Name	Type
ILC3279	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG6	N/A	15.1	GA105	View
2	chickpea-HadasxCr205-F2	LG2B	N/A	53.8	GA105	View
3	chickpea-ICC4958xPI489777-RIL-2015-2	LG3	N/A	26.06	GA105	View
4	Chickpea-ICC4958/PI489777-RIL-2020	LG03	N/A	121.41	GA105	View