GA2, GA2 (genetic_marker) Cicer arietinum

Name	GA2
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(CT)11
Primer 1	GA2.Forward primer: TGCATTGGAAATACAGCATGA
Primer 2	GA2.Reverse primer: AATTTTGGTTCGCCACAAAC
Product Length	144
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG4	N/A	71.7	GA2	View
2	chickpea-ICC4958xPI489777-RIL-2012-2	LG4	N/A	91.5	GA2	View
3	chickpea-ICC4958xPI489777-RIL-F10	LG4	N/A	49.9	GA2	View
4	chickpea-HadasxCr205-F2	LG4B	N/A	37.8	GA2	View
5	chickpea-LasseterxPI527930-F2	LG4	N/A	67.1	GA2	View
6	chickpea-ILC72xCr5-10-RIL-2006	LG4	N/A	43.1	GA2	View
7	chickpea-ICC4958xPI489777-RIL-F10-2012	LG04	N/A	43.41	GA2	View
8	chickpea-ICC4958xPI489777-RIL-2010	LG4	N/A	193.6	GA2	View
9	chickpea-ICC4958xPI489777-RIL-2015-2	LG4	N/A	84.45	GA2	View
10	Chickpea-ICCL81001_x_Cr5-9-RIL	LG4	N/A	129.2	GA2	View
11	Chickpea-ICC4958/PI489777-RIL-2020	LG04	N/A	151.91	GA2	View
12	Chickpea-RIP12-Ortega	LG04	N/A	10	GA02	View